Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS177A19

Clone ID RBdS177A19
HP ID HP09254
Gene ID 79823
Gene Symbol C2orf34
Protein Name chromosome 2 open reading frame 34
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_024766.3
Length of RefSeq (bp) 1611
Chromosome 2p21
Reference DDBJ accession
UniGene Hs.468349
5'-terminal sequence GTCCAGTGAGATGGAGTCGCGAGTCGCGGACGCTGGGACCGGCGAGACCGCGCGAGCAGC
2011.08.28