RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - CAMKMT

Gene ID	NCBI Gene 79823 \| KEGG hsa:79823
Gene Symbol	CAMKMT
Protein Name	calmodulin-lysine N-methyltransferase
Synonyms	C2orf34\|CLNMT\|CaM KMT\|Cam\|KMT

Ortholog resource in our bank

  CAMKMT

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	mRNA RefSeqs/DDBJ accession⁽¹⁾
Catalog number	5'-terminal sequence⁽²⁾
HKR470819	RBdS177A19	pGCAP10	NM_024766.3
HKR470819	GTCCAGTGAGATGGAGTCGCGAGTCGCGGACGCTGGGACCGGCGAGACCGCGCGAGCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl