Prev. |  KEGG KO K18826 > 

RIKEN DNA Bank Human Resource - CAMKMT

Gene ID NCBI Gene 79823 |  KEGG hsa:79823
Gene Symbol CAMKMT
Protein Name calmodulin-lysine N-methyltransferase
Synonyms C2orf34|CLNMT|CaM KMT|Cam|KMT
Ortholog resources KEGG ortholog (KEGG orthology K18826) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR470819 RBdS177A19 pGCAP10 NM_024766.3  
GTCCAGTGAGATGGAGTCGCGAGTCGCGGACGCTGGGACCGGCGAGACCGCGCGAGCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl