Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09250

HP ID(1) HP09250
Gene ID(2) 91574
Gene Symbol finder C12orf65
Protein Name chromosome 12 open reading frame 65
RefSeq NM_152269.3
Length of RefSeq (bp) 1673
Chromosome 12q24.31
Reference DDBJ accession
UniGene Hs.319128

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS156P07 pGCAP10 GGCTGAGGTGATTTGGATATCCCTAGAACGTTGAGGGCACGAGTCGGGTCCTGAGACCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl