Prev. | 

RIKEN DNA Bank Human Resource - C12orf65

Gene ID NCBI Gene 91574 |  KEGG hsa:91574
Gene Symbol C12orf65
Protein Name chromosome 12 open reading frame 65
Synonyms COXPD7|SPG55
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008190 IRAK020H22 pCMV-SPORT6 BC018145 NM_152269 Full
HGY094638 IRAL036J22 pDNR-LIB BC020885 NM_152269
HGY100202 IRAL050I10 pOTB7 BC062329 NM_152269 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR462767 RBdS156P07 pGCAP10 NM_152269.3  
GGCTGAGGTGATTTGGATATCCCTAGAACGTTGAGGGCACGAGTCGGGTCCTGAGACCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl