Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156P07

Clone ID RBdS156P07
HP ID HP09250
Gene ID 91574
Gene Symbol C12orf65
Protein Name chromosome 12 open reading frame 65
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_152269.3
Length of RefSeq (bp) 1673
Chromosome 12q24.31
Reference DDBJ accession
UniGene Hs.319128
5'-terminal sequence GGCTGAGGTGATTTGGATATCCCTAGAACGTTGAGGGCACGAGTCGGGTCCTGAGACCAG
2011.08.28