Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09215

HP ID(1) HP09215
Gene ID(2) 55159
Gene Symbol finder RFWD3
Protein Name ring finger and WD repeat domain 3
RefSeq NM_018124.3
Length of RefSeq (bp) 4952
Chromosome 16q22.3
Reference DDBJ accession
UniGene Hs.567525

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS154F20 pGCAP10 GGCATTCGGAGTGCGGCCGAGGTAACTACCGAGTCTTCGGCGGGCTCGCGAGCCCGGCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl