Prev. |  KEGG KO K15691 > 

RIKEN DNA Bank Human Resource - RFWD3

Gene ID NCBI Gene 55159 |  KEGG hsa:55159
Gene Symbol RFWD3
Protein Name ring finger and WD repeat domain 3
Synonyms FANCW|RNF201
Ortholog resource in our bank

  RFWD3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB17490 pcDNA3.1 FLAG-hRFWD3 wt Expression vector of human ring finger and WD repeat domain 3 (RFWD3) wild type.
RDB17491 pcDNA3.1 FLAG-hRFWD3 C315A Expression vector of human ring finger and WD repeat domain 3 (RFWD3) mutant, C315A, RING finger domain mutation.
RDB17492 pcDNA3.1 FLAG-hRFWD3 I639K Expression vector of human ring finger and WD repeat domain 3 (RFWD3) mutant, I639K, chromatin localization-defective mutation.
RDB17493 pcDNA3.1 FLAG-hRFWD3 S46/63A Expression vector of human ring finger and WD repeat domain 3 (RFWD3) mutant, S46/63A, non-phosphorylatable mutation.
RDB17494 pcDNA3.1 FLAG-hRFWD3 aa 1-278 Expression vector of N-terminal region of human ring finger and WD repeat domain 3 (RFWD3), aa 1-278, RAD51 interaction region.
RDB17495 pcDNA3.1 FLAG-hRFWD3 LQP/AAA Expression vector of human ring finger and WD repeat domain 3 (RFWD3) mutant, LQP/AAA, LQP motifs replaced by triple alanines.
RDB17496 CSII FLAG-hRFWD3 wt Lentivirus expression vector of human ring finger and WD repeat domain 3 (RFWD3) wild type.
RDB17497 CSII FLAG-hRFWD3 C315A Lentivirus expression vector of human ring finger and WD repeat domain 3 (RFWD3) mutant, C315A, RING finger domain mutation.
RDB17498 CSII FLAG-hRFWD3 I639K Lentivirus expression vector of human ring finger and WD repeat domain 3 (RFWD3) mutant, I639K, chromatin localization-defective mutation.
RDB17499 CSII FLAG-hRFWD3 S46/63A Lentivirus expression vector of human ring finger and WD repeat domain 3 (RFWD3) mutant, S46/63A, non-phosphorylatable mutation.
RDB17500 CSII FLAG-hRFWD3 C315A/I639K Lentivirus expression vector of human ring finger and WD repeat domain 3 (RFWD3) mutant, C315A/I639K (C315A, RING finger domain mutation. I639K, chromatin localization-defective mutation).
RDB17501 CSII FLAG-hRFWD3 LQP/AAA Lentivirus expression vector of human ring finger and WD repeat domain 3 (RFWD3) mutant, LQP/AAA, LQP motifs replaced by triple alanines.
RDB17502 pENTR hRFWD3 Gateway(R) Entry vector of human ring finger and WD repeat domain 3 (RFWD3).

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY053505 IRAK133M17 pBluescript BC059371 NM_018124 Full/var
HGY081644 IRAL004B20 pOTB7 BC002574 NM_018124 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR461740 RBdS154F20 pGCAP10 NM_018124.3  
GGCATTCGGAGTGCGGCCGAGGTAACTACCGAGTCTTCGGCGGGCTCGCGAGCCCGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl