Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09167

HP ID(1) HP09167
Gene ID(2) 55285
Gene Symbol finder RBM41
Protein Name RNA binding motif protein 41
RefSeq NM_018301.2
Length of RefSeq (bp) 1689
Chromosome Xq22.1-q24
Reference DDBJ accession
UniGene Hs.139053

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS110I10 pGCAP10 GGCGCGGCCTATTTACCCNAGTTGGAGGTAGGGGCCTGTGGAAACATGAAGAGGGTAAAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl