Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110I10

Clone ID RBdS110I10
HP ID HP09167
Gene ID 55285
Gene Symbol RBM41
Protein Name RNA binding motif protein 41
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_018301.2
Length of RefSeq (bp) 1689
Chromosome Xq22.1-q24
Reference DDBJ accession
UniGene Hs.139053
5'-terminal sequence GGCGCGGCCTATTTACCCNAGTTGGAGGTAGGGGCCTGTGGAAACATGAAGAGGGTAAAC
2011.08.28