Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09147

HP ID(1) HP09147
Gene ID(2) 5957
Gene Symbol finder RCVRN
Protein Name recoverin
RefSeq NM_002903.2
Length of RefSeq (bp) 1217
Chromosome 17p13.1
Reference DDBJ accession
UniGene Hs.80539

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS105M23 pGCAP10 GAGCCTTGAGCCCAGCCTGCGGCCAGGGGACCACGCACGTCCCACCCACCCAGCGACTCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl