Prev. |  Human A to Z list >  R >  RCVRN > 

NRCD Human cDNA Clone - RBdS105M23

Catalog Number HKR442311
Clone Name RBdS105M23
Clone info. Plasmid clone of human RCVRN cDNA with SV40 promoter
Vector plasmidClick for information pGCAP10
5'-terminal sequence(1) GAGCCTTGAGCCCAGCCTGCGGCCAGGGGACCACGCACGTCCCACCCACCCAGCGACTCC
Sequence, submitted(2) AB593156 link 01
 
Sequence, refered NM_002903.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) RCVRN (NCBI Gene 5957) finder other clones with this gene.
Synonyms RCV1
Protein Name recoverin
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Distribution information

Ordering Information [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR442311 RBdS105M23 DNA solution

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

original Oshikawa, M., Full-length transcriptome analysis of human retina-derived cell lines ARPE-19 and Y79 using the vector-capping method. Invest. Ophthalmol. Vis. Sci. 52 (9): 6662-6670 (2011). PMID 21697133.

2017.04.06

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_170401.pl