Prev. |  Human A to Z list >   >   > 

RBdS105M23 - NRCD Human cDNA Clone

Catalog Number HKR442311
Clone Name RBdS105M23
Clone info. Plasmid clone of human RCVRN cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) GAGCCTTGAGCCCAGCCTGCGGCCAGGGGACCACGCACGTCCCACCCACCCAGCGACTCC
Sequence, submitted(3) AB593156 [link]
 
Sequence, refered NM_002903.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(4)  (NCBI Gene 5957)  other clone of in our bank
Protein Name
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR442311 RBdS105M23 DNA solution

Sequence information

Restriction map is not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
RBdS105M23a.seq   RBdS105M23c.seq   RBdS105M23.pdf

References and tips

Featured content

Reference

original Oshikawa, M., Full-length transcriptome analysis of human retina-derived cell lines ARPE-19 and Y79 using the vector-capping method. Invest. Ophthalmol. Vis. Sci. 52 (9): 6662-6670 (2011). PMID 21697133.

2021.12.10

NRCDhumcloneList_RB_210404.csv - DataSheet_NRCD_html_210920.pl