Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09133

HP ID(1) HP09133
Gene ID(2) 146059
Gene Symbol finder CDAN1
Protein Name congenital dyserythropoietic anemia, type I
RefSeq NM_138477.2
Length of RefSeq (bp) 4757
Chromosome 15q15.2
Reference DDBJ accession
UniGene Hs.599232

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS105E10 pGCAP10 GGCCCCGACCGGGATGGCGGCCGTTTTGGAGTCGCTGCTGCGAGAAGAGGTGTCGGTCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl