Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105E10

Clone ID RBdS105E10
HP ID HP09133
Gene ID 146059
Gene Symbol CDAN1
Protein Name congenital dyserythropoietic anemia, type I
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_138477.2
Length of RefSeq (bp) 4757
Chromosome 15q15.2
Reference DDBJ accession
UniGene Hs.599232
5'-terminal sequence GGCCCCGACCGGGATGGCGGCCGTTTTGGAGTCGCTGCTGCGAGAAGAGGTGTCGGTCGC
2011.08.28