Prev. |  KEGG KO K19531 > 

RIKEN DNA Bank Human Resource - CDAN1

Gene ID NCBI Gene 146059 |  KEGG hsa:146059
Gene Symbol CDAN1
Protein Name codanin 1
Synonyms CDA1|CDAI|CDAN1A|DLT|PRO1295
Ortholog resources KEGG ortholog (KEGG orthology K19531) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082839 IRAL007B15 pOTB7 BC001092 NM_138477 Partial/var
HGY089285 IRAL023D13 pOTB7 BC008334 NM_138477 Partial/var
HGY089286 IRAL023D14 pOTB7 BC008333 NM_138477 Partial/var
HGY099155 IRAL047O19 pOTB7 BC052568 NM_138477 Full/var
HGY100344 IRAL050O08 pOTB7 BC066640 NM_138477 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE104847 M01C062B23 pDONR221 06_05-G12 BC066640 NM_138477  
HGE104895 M01C062D23 pDONR221 06_05-G12 BC066640 NM_138477  
HGE104943 M01C062F23 pDONR221 06_05-G12 BC066640 NM_138477  
HGE104991 M01C062H23 pDONR221 06_05-G12 BC066640 NM_138477  
HGE105039 M01C062J23 pDONR221 06_05-G12 BC066640 NM_138477  
HGE105087 M01C062L23 pDONR221 06_05-G12 BC066640 NM_138477  
HGE105135 M01C062N23 pDONR221 06_05-G12 BC066640 NM_138477  
HGE105183 M01C062P23 pDONR221 06_05-G12 BC066640 NM_138477  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR442106 RBdS105E10 pGCAP10 NM_138477.2  
GGCCCCGACCGGGATGGCGGCCGTTTTGGAGTCGCTGCTGCGAGAAGAGGTGTCGGTCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl