Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09130

HP ID(1) HP09130
Gene ID(2) 117584
Gene Symbol finder RFFL
Protein Name ring finger and FYVE-like domain containing 1
RefSeq NM_001017368.1
Length of RefSeq (bp) 4137
Chromosome 17q12
Reference DDBJ accession
UniGene Hs.13680

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS105D10 pGCAP10 GGGGGGCCGACTTCCTGGGGCCGCCCGTGAGGATGTCGCGACCGCCCCCGGGTGCCCCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl