Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105D10

Clone ID RBdS105D10
HP ID HP09130
Gene ID 117584
Gene Symbol RFFL
Protein Name ring finger and FYVE-like domain containing 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001017368.1
Length of RefSeq (bp) 4137
Chromosome 17q12
Reference DDBJ accession
UniGene Hs.13680
5'-terminal sequence GGGGGGCCGACTTCCTGGGGCCGCCCGTGAGGATGTCGCGACCGCCCCCGGGTGCCCCTC
2011.08.28