Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09098

HP ID(1) HP09098
Gene ID(2) 81847
Gene Symbol finder RNF146
Protein Name ring finger protein 146
RefSeq NM_030963.2
Length of RefSeq (bp) 2158
Chromosome 6q22.1-q22.33
Reference DDBJ accession
UniGene Hs.267120

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS083P01 pGCAP10 TGGCTCCGAGGCCAGAGAGAAAAGACTGCGAGGTGGCCGCAGCTGTGGCCGGAGAGCACA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl