Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083P01

Clone ID RBdS083P01
HP ID HP09098
Gene ID 81847
Gene Symbol RNF146
Protein Name ring finger protein 146
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_030963.2
Length of RefSeq (bp) 2158
Chromosome 6q22.1-q22.33
Reference DDBJ accession
UniGene Hs.267120
5'-terminal sequence TGGCTCCGAGGCCAGAGAGAAAAGACTGCGAGGTGGCCGCAGCTGTGGCCGGAGAGCACA
2011.08.28