Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09081

HP ID(1) HP09081
Gene ID(2) 9904
Gene Symbol finder RBM19
Protein Name RNA binding motif protein 19
RefSeq NM_016196.3
Length of RefSeq (bp) 4217
Chromosome 12q24.13-q24.21
Reference DDBJ accession
UniGene Hs.7482

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS083F02 pGCAP10 GGTGACTGTGTTCCGGCTCGGTAAAGATGGCGGCGCCCAGGGCGGTAGCGTGAAACTTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl