Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083F02

Clone ID RBdS083F02
HP ID HP09081
Gene ID 9904
Gene Symbol RBM19
Protein Name RNA binding motif protein 19
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_016196.3
Length of RefSeq (bp) 4217
Chromosome 12q24.13-q24.21
Reference DDBJ accession
UniGene Hs.7482
5'-terminal sequence GGTGACTGTGTTCCGGCTCGGTAAAGATGGCGGCGCCCAGGGCGGTAGCGTGAAACTTGG
2011.08.28