Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09021

HP ID(1) HP09021
Gene ID(2) 83732
Gene Symbol finder RIOK1
Protein Name RIO kinase 1 (yeast)
RefSeq NM_031480.2
Length of RefSeq (bp) 2495
Chromosome 6p24.3
Reference DDBJ accession
UniGene Hs.437474

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS075D04 pGCAP10 GGGTTGGGGTGGCAGGGTGGTGGATCTGTCGGTCCCGTTTTCCCGTCGCACGTGGTGGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl