Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075D04

Clone ID RBdS075D04
HP ID HP09021
Gene ID 83732
Gene Symbol RIOK1
Protein Name RIO kinase 1 (yeast)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_031480.2
Length of RefSeq (bp) 2495
Chromosome 6p24.3
Reference DDBJ accession
UniGene Hs.437474
5'-terminal sequence GGGTTGGGGTGGCAGGGTGGTGGATCTGTCGGTCCCGTTTTCCCGTCGCACGTGGTGGCC
2011.08.28