Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08922

HP ID(1) HP08922
Gene ID(2) 51308
Gene Symbol finder REEP2
Protein Name receptor accessory protein 2
RefSeq NM_016606.2
Length of RefSeq (bp) 2117
Chromosome 5q31
Reference DDBJ accession
UniGene Hs.416090

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS022F14 pGCAP10 GGCCCCCGCGGCGGCTGCTGCAGCGGCTGCTGCTGCTACTGCGGCTCCTGCTGCCGCCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl