Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022F14

Clone ID RBdS022F14
HP ID HP08922
Gene ID 51308
Gene Symbol REEP2
Protein Name receptor accessory protein 2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_016606.2
Length of RefSeq (bp) 2117
Chromosome 5q31
Reference DDBJ accession
UniGene Hs.416090
5'-terminal sequence GGCCCCCGCGGCGGCTGCTGCAGCGGCTGCTGCTGCTACTGCGGCTCCTGCTGCCGCCGC
2011.08.28