Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08915

HP ID(1) HP08915
Gene ID(2) 23322
Gene Symbol finder RPGRIP1L
Protein Name RPGRIP1-like
RefSeq NM_015272.2
Length of RefSeq (bp) 6199
Chromosome 16q12.2
Reference DDBJ accession
UniGene Hs.298382

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS022C06 pGCAP10 GGGCCAGCCGCCCGCCACGCTGTCGGCGCTATAGCAACGGTAGCTAGCTGCAGGGCCAGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl