Prev. |  KEGG KO K16550 > 

RIKEN DNA Bank Human Resource - RPGRIP1L

Gene ID NCBI Gene 23322 |  KEGG hsa:23322
Gene Symbol RPGRIP1L
Protein Name RPGRIP1 like
Synonyms CORS3|FTM|JBTS7|MKS5|NPHP8|PPP1R134
Ortholog resources KEGG ortholog (KEGG orthology K16550) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR408854 RBdS022C06 pGCAP10 NM_015272.2  
GGGCCAGCCGCCCGCCACGCTGTCGGCGCTATAGCAACGGTAGCTAGCTGCAGGGCCAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl