Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08835

HP ID(1) HP08835
Gene ID(2) 54902
Gene Symbol finder TTC19
Protein Name tetratricopeptide repeat domain 19
RefSeq NM_017775.2
Length of RefSeq (bp) 2784
Chromosome 17p12
Reference DDBJ accession
UniGene Hs.462316

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS007M13 pGCAP10 CGGAGTGCAGTGCGCAGAGGACGCGGCGGGAGCATGTTCCGGCTCCTGAGCTGGAGCCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl