DNA Bank Top |  KEGG KO K18169 > 

RIKEN DNA Bank Human Resource - TTC19

Gene ID NCBI Gene 54902 |  KEGG hsa:54902
Gene Symbol TTC19
Protein Name tetratricopeptide repeat domain 19
Synonyms 2010204O13Rik|MC3DN2

Link

Ortholog resource in our bank

  TTC19


External database

human TTC19

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB04613 SEREX clone NGO-Br-14 (ID 820, 821) #1 SEREX clone NGO-Br-14 (ID 820, 821) #1    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY090887 IRAL027D15 pOTB7 BC011698 NM_017775 Partial
HGY103496 IRAL058M08 pOTB7 BC073796 NM_017775 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR403101 RBdS007M13 pGCAP10 NM_017775.2  
CGGAGTGCAGTGCGCAGAGGACGCGGCGGGAGCATGTTCCGGCTCCTGAGCTGGAGCCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl