Prev. |  Human A to Z list >  T >  TTC19 > 

RBdS007M13 - NRCD Human cDNA Clone

Catalog Number HKR403101
Clone Name RBdS007M13
Clone info. Plasmid clone of human TTC19 cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) CGGAGTGCAGTGCGCAGAGGACGCGGCGGGAGCATGTTCCGGCTCCTGAGCTGGAGCCTG
Sequence, submitted(3) n.a.
 
Sequence, refered NM_017775.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) TTC19 (NCBI Gene 54902)  other clone of TTC19 in our bank
Synonyms 2010204O13Rik|MC3DN2
Protein Name tetratricopeptide repeat domain 19
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR403101 RBdS007M13 DNA solution

How to cite this biological resource

Materials & Methods section:

The RBdS007M13 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR403101).

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2023.05.03

NRCDhumcloneList_RB_2023Apr25.csv - GNP_filter3_NRCD_html_230424.pl