Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08827

HP ID(1) HP08827
Gene ID(2) 9727
Gene Symbol finder RAB11FIP3
Protein Name RAB11 family interacting protein 3 (class II)
RefSeq NM_014700.2
Length of RefSeq (bp) 4272
Chromosome 16p13.3
Reference DDBJ accession
UniGene Hs.531642

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS007I20 pGCAP10 GGGCGTTAGTTCTCCGGGTACCTCAGGCGCCTCAGCCTCCTTAGTCTCCTCATCCTGCTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl