Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RAB11FIP3

Gene ID (NCBI) 9727
Gene Symbol RAB11FIP3
Protein Name RAB11 family interacting protein 3 (class II)
Synonyms CART1|Rab11-FIP3
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY099160 IRAL047O24 pOTB7 BC051360 NM_014700

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE093634 M01C034B10 pDONR221 MGC06-H05 BC051360 NM_014700  
HGE093682 M01C034D10 pDONR221 MGC06-H05 BC051360 NM_014700  
HGE093730 M01C034F10 pDONR221 MGC06-H05 BC051360 NM_014700  
HGE093778 M01C034H10 pDONR221 MGC06-H05 BC051360 NM_014700  
HGE093826 M01C034J10 pDONR221 MGC06-H05 BC051360 NM_014700  
HGE093874 M01C034L10 pDONR221 MGC06-H05 BC051360 NM_014700  
HGE093922 M01C034N10 pDONR221 MGC06-H05 BC051360 NM_014700  
HGE093970 M01C034P10 pDONR221 MGC06-H05 BC051360 NM_014700  
HGE110042 M01C075B18 pDONR221 06-2_01-D09 BC051360 NM_014700  
HGE110090 M01C075D18 pDONR221 06-2_01-D09 BC051360 NM_014700  
HGE110138 M01C075F18 pDONR221 06-2_01-D09 BC051360 NM_014700  
HGE110186 M01C075H18 pDONR221 06-2_01-D09 BC051360 NM_014700  
HGE110234 M01C075J18 pDONR221 06-2_01-D09 BC051360 NM_014700  
HGE110282 M01C075L18 pDONR221 06-2_01-D09 BC051360 NM_014700  
HGE110330 M01C075N18 pDONR221 06-2_01-D09 BC051360 NM_014700  
HGE110378 M01C075P18 pDONR221 06-2_01-D09 BC051360 NM_014700  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR403012 RBdS007I20 pGCAP10 NM_014700.2  
GGGCGTTAGTTCTCCGGGTACCTCAGGCGCCTCAGCCTCCTTAGTCTCCTCATCCTGCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl