Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08762

HP ID(1) HP08762
Gene ID(2) 64793
Gene Symbol finder CCDC21
Protein Name coiled-coil domain containing 21
RefSeq NM_022778.2
Length of RefSeq (bp) 3961
Chromosome 1p36.11
Reference DDBJ accession
UniGene Hs.63795

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd95C04 pGCAP10 GGGGGCCAAACGACGCGCGTTCTGTGGCGCGCGGCCTGGCGGGCGTGCAACGGCCGTTAG
RBdS022E20 pGCAP10 GGTGCAACGGCCGTTAGAGGAGCTGAGGGAGGGAACCACCGCTCACCGCAGACGTAGTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl