Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022E20

Clone ID RBdS022E20
HP ID HP08762
Gene ID 64793
Gene Symbol CCDC21
Protein Name coiled-coil domain containing 21
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_022778.2
Length of RefSeq (bp) 3961
Chromosome 1p36.11
Reference DDBJ accession
UniGene Hs.63795
5'-terminal sequence GGTGCAACGGCCGTTAGAGGAGCTGAGGGAGGGAACCACCGCTCACCGCAGACGTAGTGG
2011.08.28