Prev. |  KEGG KO K16766 > 

RIKEN DNA Bank Human Resource - CEP85

Gene ID NCBI Gene 64793 |  KEGG hsa:64793
Gene Symbol CEP85
Protein Name centrosomal protein 85
Synonyms CCDC21
Ortholog resource in our bank

  CEP85

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX055704 IRAK139E08 pCMV-SPORT6 BC064528 NM_022778

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR398052 RBd95C04 pGCAP10 NM_022778.2  
GGGGGCCAAACGACGCGCGTTCTGTGGCGCGCGGCCTGGCGGGCGTGCAACGGCCGTTAG
HKR408916 RBdS022E20 pGCAP10 NM_022778.2  
GGTGCAACGGCCGTTAGAGGAGCTGAGGGAGGGAACCACCGCTCACCGCAGACGTAGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl