Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08725

HP ID(1) HP08725
Gene ID(2) 84933
Gene Symbol finder C8orf76
Protein Name chromosome 8 open reading frame 76
RefSeq NM_032847.1
Length of RefSeq (bp) 1286
Chromosome 8q24.13
Reference DDBJ accession
UniGene Hs.521800

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd89G12 pGCAP10 GGCTTCCTCGTTGCCCCCGCCGCGGGCGCGAGATGGATTCCGGGTGCTGGTTGTTCGGCG
RBd91H08 pGCAP10 GGCCCCCGCCGCGGGCGCGAGATGGATTCCGGGTGCTGGTTGTTCGGCGGCGAGTTCGAG
RBdS156D21 pGCAP10 GATTCCGGGTGCTGGTTGTTCGGCGGCGAGTTCGAGGACTCGGTGTTCGAGGAGAGGCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl