Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156D21

Clone ID RBdS156D21
HP ID HP08725
Gene ID 84933
Gene Symbol C8orf76
Protein Name chromosome 8 open reading frame 76
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_032847.1
Length of RefSeq (bp) 1286
Chromosome 8q24.13
Reference DDBJ accession
UniGene Hs.521800
5'-terminal sequence GATTCCGGGTGCTGGTTGTTCGGCGGCGAGTTCGAGGACTCGGTGTTCGAGGAGAGGCCG
2011.08.28