Prev. | 

RIKEN DNA Bank Human Resource - C8orf76

Gene ID NCBI Gene 84933 |  KEGG hsa:84933
Gene Symbol C8orf76
Protein Name chromosome 8 open reading frame 76
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008424 IRAK021A24 pCMV-SPORT6 BC012379 NM_032847 Partial
HGY067036 IRAK167J20 pBluescriptR BC067796 NM_032847 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR395756 RBd89G12 pGCAP10 NM_032847.1  
GGCTTCCTCGTTGCCCCCGCCGCGGGCGCGAGATGGATTCCGGGTGCTGGTTGTTCGGCG
HKR396576 RBd91H08 pGCAP10 NM_032847.1  
GGCCCCCGCCGCGGGCGCGAGATGGATTCCGGGTGCTGGTTGTTCGGCGGCGAGTTCGAG
HKR462493 RBdS156D21 pGCAP10 NM_032847.1  
GATTCCGGGTGCTGGTTGTTCGGCGGCGAGTTCGAGGACTCGGTGTTCGAGGAGAGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl