Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08666

HP ID(1) HP08666
Gene ID(2) 83694
Gene Symbol finder RPS6KL1
Protein Name ribosomal protein S6 kinase-like 1
RefSeq NM_031464.3
Length of RefSeq (bp) 3035
Chromosome 14q24.3
Reference DDBJ accession
UniGene Hs.414481

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd80F07 pGCAP10 GGCTCTGGCGTGAAGGGCCGGTACGTGAGGGGGAGGCCTGGCCCGCGGACCCGGCTCCCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl