Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RPS6KL1

Gene ID (NCBI) 83694
Gene Symbol RPS6KL1
Protein Name ribosomal protein S6 kinase-like 1
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY028001 IRAK070A01 pBluescriptR BC036574 NM_031464
HGY086125 IRAL015F05 pOTB7 BC004540 NM_031464 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE107235 M01C068B11 pDONR221 06_08-G06 BC004540 NM_031464  
HGE107283 M01C068D11 pDONR221 06_08-G06 BC004540 NM_031464  
HGE107331 M01C068F11 pDONR221 06_08-G06 BC004540 NM_031464  
HGE107379 M01C068H11 pDONR221 06_08-G06 BC004540 NM_031464  
HGE107427 M01C068J11 pDONR221 06_08-G06 BC004540 NM_031464  
HGE107475 M01C068L11 pDONR221 06_08-G06 BC004540 NM_031464  
HGE107523 M01C068N11 pDONR221 06_08-G06 BC004540 NM_031464  
HGE107571 M01C068P11 pDONR221 06_08-G06 BC004540 NM_031464  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR392127 RBd80F07 pGCAP10 NM_031464.3  
GGCTCTGGCGTGAAGGGCCGGTACGTGAGGGGGAGGCCTGGCCCGCGGACCCGGCTCCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.12.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl