Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08647

HP ID(1) HP08647
Gene ID(2) 5864
Gene Symbol finder RAB3A
Protein Name RAB3A, member RAS oncogene family
RefSeq NM_002866.4
Length of RefSeq (bp) 1528
Chromosome 19p13.2
Reference DDBJ accession
UniGene Hs.27744

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd77F10 pGCAP10 GGCCGCTGCTGCCGCCGCCGCCGCGCAGCCCCACATCAACGCACCGGGGTCCTGTCACCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl