Prev. |  KEGG KO K07882 > 

RIKEN DNA Bank Human Resource - RAB3A

Gene ID NCBI Gene 5864 |  KEGG hsa:5864
Gene Symbol RAB3A
Protein Name RAB3A, member RAS oncogene family
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K07882) in the DNA Bank
Featured content Rab Family - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY091026 IRAL027J10 pOTB7 BC011782 NM_002866

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE099245 M01C048B21 pDONR221 MGC13-G11 BC011782 NM_002866  
HGE099293 M01C048D21 pDONR221 MGC13-G11 BC011782 NM_002866  
HGE099341 M01C048F21 pDONR221 MGC13-G11 BC011782 NM_002866  
HGE099389 M01C048H21 pDONR221 MGC13-G11 BC011782 NM_002866  
HGE099437 M01C048J21 pDONR221 MGC13-G11 BC011782 NM_002866  
HGE099485 M01C048L21 pDONR221 MGC13-G11 BC011782 NM_002866  
HGE099533 M01C048N21 pDONR221 MGC13-G11 BC011782 NM_002866  
HGE099581 M01C048P21 pDONR221 MGC13-G11 BC011782 NM_002866  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR390930 RBd77F10 pGCAP10 NM_002866.4  
GGCCGCTGCTGCCGCCGCCGCCGCGCAGCCCCACATCAACGCACCGGGGTCCTGTCACCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl