Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08577

HP ID(1) HP08577
Gene ID(2) 23429
Gene Symbol finder RYBP
Protein Name RING1 and YY1 binding protein
RefSeq NM_012234.4
Length of RefSeq (bp) 4562
Chromosome 3p13
Reference DDBJ accession
UniGene Hs.7910

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd67E07 pGCAP10 GAGTCANTCGGCGGAGGCGGCGCTGGCGGGGACTAGTCTCGTCCGGAGACTGGCGGCGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl