Prev. |  KEGG KO K11469 > 

RIKEN DNA Bank Human Resource - RYBP

Gene ID NCBI Gene 23429 |  KEGG hsa:23429
Gene Symbol RYBP
Protein Name RING1 and YY1 binding protein
Synonyms AAP1|APAP-1|DEDAF|YEAF1
Ortholog resources KEGG ortholog (KEGG orthology K11469) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY018500 IRAK046E04 pBluescriptR BC036459 NM_012234 Full
HGY093944 IRAL034O08 pOTB7 BC014959 NM_012234 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR386903 RBd67E07 pGCAP10 NM_012234.4  
GAGTCANTCGGCGGAGGCGGCGCTGGCGGGGACTAGTCTCGTCCGGAGACTGGCGGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl