Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08553

HP ID(1) HP08553
Gene ID(2) 339983
Gene Symbol finder NAT8L
Protein Name N-acetyltransferase 8-like (GCN5-related, putative)
RefSeq NM_178557.3
Length of RefSeq (bp) 5894
Chromosome 4p16.3
Reference DDBJ accession
UniGene Hs.318529

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd64A01 pGCAP10 GGGGGGCCGGGCCGGGAGGGGTCCTGCGGGCCCCGCATCCCCGTGCCCACTGCGGGGCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl