Prev. |  Human A to Z list >  N >  NAT8L > 

RBd64A01 - NRCD Human cDNA Clone

Catalog Number HKR385601
Clone Name RBd64A01
Clone info. Plasmid clone of human NAT8L cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) GGGGGGCCGGGCCGGGAGGGGTCCTGCGGGCCCCGCATCCCCGTGCCCACTGCGGGGCTC
Sequence, submitted(3) n.a.
Note match to NM_178557.4 (1-2049) CDS:full
 
Sequence, refered NM_178557.4 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) NAT8L (NCBI Gene 339983)  other clone of NAT8L in our bank
Synonyms CML3|NACED|NAT8-LIKE
Protein Name N-acetyltransferase 8 like
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR385601 RBd64A01 DNA solution

How to cite this biological resource

Materials & Methods section:

The RBd64A01 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR385601).

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(Insert 5')
Seq File
(Insert 3')
Seq File
(Upstream of poly(A))
Seq File
(contig)
PDF File
RBd64A01a.seq   RBd64A01c.seq RBd64A01z.seq RBd64A01.pdf

References and tips

Featured content

Reference


2023.07.07

NRCDhumcloneList_RB_2023May03.csv - GNP_filter3_NRCD_html_230707.pl