Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NAT8L

Gene ID (NCBI) 339983
Gene Symbol NAT8L
Protein Name N-acetyltransferase 8 like
Synonyms CML3|NACED|NAT8-LIKE
Databases KEGG hsa:339983 |  NCBI Gene 339983
Featured content Ortholog resources in the DNA Bank (KEGG orthology K18309)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR385601 RBd64A01 pGCAP10 NM_178557.3  
GGGGGGCCGGGCCGGGAGGGGTCCTGCGGGCCCCGCATCCCCGTGCCCACTGCGGGGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl