Prev. |  KEGG KO K18309 > 

RIKEN DNA Bank Human Resource - NAT8L

Gene ID NCBI Gene 339983 |  KEGG hsa:339983
Gene Symbol NAT8L
Protein Name N-acetyltransferase 8 like
Synonyms CML3|NACED|NAT8-LIKE
Ortholog resource in our bank

  NAT8L

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR385601 RBd64A01 pGCAP10 NM_178557.4 Full done
GGGGGGCCGGGCCGGGAGGGGTCCTGCGGGCCCCGCATCCCCGTGCCCACTGCGGGGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv


2023.05.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl