Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08528

HP ID(1) HP08528
Gene ID(2) 84065
Gene Symbol finder C1orf160
Protein Name chromosome 1 open reading frame 160
RefSeq NM_032125.2
Length of RefSeq (bp) 1629
Chromosome 1p36.11
Reference DDBJ accession
UniGene Hs.705410

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd60G01 pGCAP10 GAGTGGAGGCGCCGACGGCGGCCGAGACGGACATGAAGCAATATCAAGGCTCCGGCGGCG
RBdS015M12 pGCAP10 GGGAGTTCTCTGCTCTTGTTGCCGCCGCCGCCACCCCCGCCCAGGATGGCGGAAGTGGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl