Prev. |  KEGG KO K20726 > 

RIKEN DNA Bank Human Resource - TMEM222

Gene ID NCBI Gene 84065 |  KEGG hsa:84065
Gene Symbol TMEM222
Protein Name transmembrane protein 222
Synonyms C1orf160
Ortholog resource in our bank

  TMEM222

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091611 IRAL029A11 pOTB7 BC011579 NM_032125 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR384145 RBd60G01 pGCAP10 NM_032125.2  
GAGTGGAGGCGCCGACGGCGGCCGAGACGGACATGAAGCAATATCAAGGCTCCGGCGGCG
HKR406300 RBdS015M12 pGCAP10 NM_032125.2  
GGGAGTTCTCTGCTCTTGTTGCCGCCGCCGCCACCCCCGCCCAGGATGGCGGAAGTGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl