Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015M12

Clone ID RBdS015M12
HP ID HP08528
Gene ID 84065
Gene Symbol C1orf160
Protein Name chromosome 1 open reading frame 160
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_032125.2
Length of RefSeq (bp) 1629
Chromosome 1p36.11
Reference DDBJ accession
UniGene Hs.705410
5'-terminal sequence GGGAGTTCTCTGCTCTTGTTGCCGCCGCCGCCACCCCCGCCCAGGATGGCGGAAGTGGAG
2011.08.28