Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08522

HP ID(1) HP08522
Gene ID(2) 118924
Gene Symbol finder C10orf4?
Protein Name chromosome 10 open reading frame 4?
RefSeq NM_145246.3
Length of RefSeq (bp) 2400
Chromosome 10q23.33
Reference DDBJ accession
UniGene Hs.658192

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd59E02 pGCAP10 GAGAGGCGGGTTGCGGGCGGCGGCGGCGGCGGCGGCGGTGGTGGTTGTGGCGAGGCTGTG
RBdS154I03 pGCAP10 GGGCGGCGGCGGCGGCGGTGGTGGTTGTGGCGAGGCTGTGCGGCAGGGCGCACGGGACCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl